Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
International Journal of Oncology
Join Editorial Board Propose a Special Issue
Print ISSN: 1019-6439 Online ISSN: 1791-2423
Journal Cover
July-2024 Volume 65 Issue 1

Full Size Image

Cover Legend PDF

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
July-2024 Volume 65 Issue 1

Full Size Image

Cover Legend PDF

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML

  • Supplementary Files
    • Supplementary_Data.pdf
Article Open Access

Complement regulatory protein CD46 promotes bladder cancer metastasis through activation of MMP9

  • Authors:
    • Thuy Nguyen Thi
    • Hien Duong Thanh
    • Van-Tan Nguyen
    • Se-Young Kwon
    • Changjong Moon
    • Eu Chang Hwang
    • Chaeyong Jung
  • View Affiliations / Copyright

    Affiliations: Department of Anatomy, Chonnam National University Medical School, Gwangju 61469, Republic of Korea, Department of Biomedical Science, Chonnam National University Medical School, Gwangju 61469, Republic of Korea, College of Veterinary Medicine, Chonnam National University, Gwangju 61186, Republic of Korea, Department of Urology, Chonnam National University Medical School, Gwangju 61469, Republic of Korea
    Copyright: © Thi et al. This is an open access article distributed under the terms of Creative Commons Attribution License.
  • Article Number: 71
    |
    Published online on: May 31, 2024
       https://doi.org/10.3892/ijo.2024.5659
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:


Abstract

CD46, a transmembrane protein known for protecting cells from complement‑mediated damage, is frequently dysregulated in various types of cancer. Its overexpression in bladder cancers safeguards the cancer cells against both complement and antibody‑mediated cytotoxicity. The present study explored a new role of CD46 in facilitating cancer cell invasion and metastasis, examining its regulatory effect on matrix metalloproteases (MMPs) and their effect on the metastatic capability of bladder cancer cells. Specifically, CD46 alteration positively influenced MMP9 expression, but not MMP2, in several bladder cancer cell lines. Furthermore, CD46 overexpression triggered phosphorylation of p38 MAPK and protein kinase B (AKT), leading to enhanced activator protein 1 (AP‑1) activity via c‑Jun upregulation. The inhibition of p38 or AKT pathways attenuated the CD46‑induced MMP9 and AP‑1 upregulation, indicating that the promotion of MMP9 by CD46 involved activating both p38 MAPK and AKT. Functionally, the upregulation of MMP9 by CD46 translated to increased migratory and invasive capabilities of bladder cancer cells, as well as enhanced in vivo metastasis. Overall, the present study revealed a novel role for CD46 as a metastasis promoter through MMP9 activation in bladder cancers and highlighted the regulatory mechanism of CD46‑mediated MMP9 promotion via p38 MAPK and AKT activation.

Introduction

CD46, a transmembrane protein, plays pivotal roles in various biological processes, including immune activation and the modulation of adaptive immunity. Notably, it regulates complement activity, a crucial component of the immune system that targets invading pathogens and damaged cells (1). CD46 functions as a cofactor in the degradation of complement components, thereby inhibiting complement activation. This inhibition is essential to prevent excessive or inappropriate activation of the complement system, which could result in tissue damage and autoimmune disorders. CD46 is widely distributed in tissues, being expressed by almost all human cell populations, with the exception of erythrocytes (2). It is commonly expressed in four distinct isoforms, resulting from alternative mRNA splicing of a single gene transcript (3).

Beyond its role in complement regulation, CD46 has been linked to several types of cancer and other diseases (4-9). A number of tumor types exhibit CD46 overexpression. For instance, in hepatocellular carcinoma, CD46 expression is ~6 times higher than in liver cirrhosis and chronic hepatitis (10). High concentrations of CD46 have been observed in the sera of cancer patients (11). CD46 expression is an unfavorable prognostic factor in ovarian cancer, breast cancer and hepatocellular carcinoma (12-14). Additionally, CD46 contributes to the tumorigenesis and development of bladder cancer (15). Our previous research demonstrated that restoring CD46 expression in bladder cancer cells conferred protection against cetuximab-mediated inhibition of phosphoinositide-3-kinase (PI3K)/protein kinase B (AKT) and extracellular signal-regulated kinase (ERK) phosphorylation (16). This restoration also protected cells from complement-dependent cytotoxicity and antibody-dependent cellular cytotoxicity induced by cetuximab. Thus, CD46 shows a protective effect in cancer cells against both direct (via involvement of PBMC or complement) and indirect cytotoxic activities of cetuximab in bladder cancer cells.

Studies have underscored the importance of matrix metalloproteinases (MMPs) in tumor growth and metastasis, with a focus on MMP2 and MMP9 (17,18). Researchers have characterized promoter region of MMP9, identifying binding sites for several transcription factors such as activator protein 1 (AP-1), specificity protein 1 (SP-1), E-twenty six (Ets) and nuclear factor kappa B (NF-κB) (19). Further research indicates that AP-1 activation is essential for sustaining cancer cell invasion and aiding epithelial wound healing (20-22). This activation predominantly occurs through the mitogen-activated protein kinase (MAPK) cascades. The MAPK family is divided into three primary groups: ERK, c-Jun N-terminal kinase (JNK) and p38 MAPK. Certain MAPK family members, including ERK1/2 and p38 MAPK, along with PI3K/AKT, play a pivotal role in upregulating MMP9 expression (23-27). Additionally, AP-1 activation is primarily facilitated by the PI3K/AKT and JNK pathways, working in synergy (28).

Despite significant progress in understanding CD46, a number of aspects of its functions and the molecular mechanisms involved in cancer cell metastasis remain unclear. Our previous research demonstrated that CD46 is highly expressed in bladder cancers, where it helps protect cancer cells from various cytotoxic insults (16,29). Moreover, CD46 appears to influence cell migration by altering the expression of several cytoskeletal proteins (30). Given the strong correlation between MMPs, particularly MMP9, and the progression and recurrence of bladder tumors (18,31,32), the present study aimed to investigate the impact of CD46 on MMP9 in bladder cancer and to elucidate the specific mechanisms related to CD46 and MMP9 in bladder cancer cells.

Materials and methods

Cell lines and cell culture

Human bladder cancer cell lines [J82, 5637, HT-1376 (cat. no. CRL-1472), UM-UC-3], melanoma cells (M010119), prostate cancer cells (LNCaP), colon cancer cells (HCT116) and lung cancer cells (A549) were procured from the American Type Culture Collection. 253J cells were kindly provided by Dr Wun-Jae Kim (Chungbuk National University, Korea). J82, 5637, HT-1376, UM-UC-3, 253J, M010119 and LNCaP cells were cultured in RPMI 1640 medium (Welgene, Inc.) supplemented with 5% heat-inactivated fetal bovine serum (FBS; Gibco; Thermo Fisher Scientific, Inc.) and 1% penicillin/streptomycin (Gibco; Thermo Fisher Scientific, Inc.). HCT116 and A549 cells were cultured in Dulbecco's modified Eagle's medium (DMEM; Welgene, Inc.) supplemented with 5% heat-inactivated fetal bovine serum (FBS; Gibco; Thermo Fisher Scientific, Inc.) and 1% penicillin/streptomycin (Gibco; Thermo Fisher Scientific, Inc.). Cultivation was at 37°C in an atmosphere containing 5% CO2, with media changes every 2-3 days. To establish cell lines with CD46 overexpression, the lentiviral vector pBlasti-eGFP-CD46 kindly provided by Dr Silvio Hemmi (Institute of Molecular Life Sciences, University of Zurich, Zurich, Switzerland) was co-transfected with helper in the 2nd generation transfection system into 293T cells, as detailed in a previous study (29). The 293T cells were cultured in DMEM supplemented with 10% FBS at a temperature of 37°C and 5% CO2. Following a 48 h incubation period at 37°C; the supernatant of the 293T cells were collected and the lentivirus was concentrated by subjecting to centrifugation at 2,100 x g for 5 min at 4°C and filtering the supernatant through a 0.45 µm filter. The harvested lentiviral vectors were then introduced into the target cells for transduction. Subsequently, cell lines were plated into a 6-well plate and the cells were cultured until they reached 80% confluence. To generate stable cell lines, cells were transduced with these lentiviral vectors in a milieu containing polybrene at a concentration of 8 µg/ml. Then, lentivirus was added and co-cultured with the cells at 37°C for 24 h (Multiplicity of infection, 30). After that, the medium was replaced, and then culture continued in a 5% CO2 and 37°C incubator for another 48 h. Following a 72 h incubation period, cells underwent a selection process using 10 µg/ml blasticidin (MilliporeSigma), over a course of 3 days.

Western blotting

For the cancer cells, protein extraction was performed using Pro-Prep (cat. no. 17081; Intron Biotechnology, Inc.). The quantification of proteins was conducted using the BCA Protein Assay kit (cat. no. 23227; Thermo Fisher Scientific, Inc.). Proteins (15 µg) were subjected to separation on a 7.5% SDS-polyacrylamide gel, using the Bio-Rad electroporation system (Bio-Rad Laboratories, Inc.), followed by transfer to PVDF membranes (cat. no. IPVH00010; MilliporeSigma). After the membranes were blocked with 3% BSA (BioShop) in tris-buffered saline containing 0.1% Tween-20 (TBST) at room temperature for 1 h and then incubated at 4°C overnight with primary antibodies. The primary antibodies used included: CD46 (1:2,000; cat. no. ab108307; Abcam); MMP9 (1:1,000; cat. no. 7-11C; Santa Cruz Biotechnology, Inc.), phosphorylated (p-)AKT (1:1,000; cat. no. 05-669; MilliporeSigma), p38α (1:1,000; cat. no. sc-535; Santa Cruz Biotechnology, Inc.), JNK1/3 (1:1,000; cat. no. sc-474; Santa Cruz Biotechnology, Inc.), p-JNK (1:1,000; cat. no. sc-6254 Santa Cruz Biotechnology, Inc.), ERK1 (1:1,000; cat. no. sc-271269 Santa Cruz Biotechnology, Inc.), c-Fos (1:1,000; cat. no. sc-166940; Santa Cruz Biotechnology, Inc.), p-c-Fos (1:1,000; cat. no. sc-81485; Santa Cruz Biotechnology, Inc.), c-Jun (1:1,000; cat. no. sc-1694; Santa Cruz Biotechnology, Inc.), p-c-Jun (1:1,000; cat. no. sc-822; Santa Cruz Biotechnology, Inc.); p-p38 (1:2,000; cat. no. 05-1059; MilliporeSigma), AKT (1:2,000; cat. no. 9272; Cell Signaling Technology, Inc.); MMP2 (1:2,000; cat. no. NB200-114; Novus Biologicals; Bio-Techne); p-ERK (1:2,000; cat. no. 05-797R; MilliporeSigma); and β-actin (1:2,000; cat. no. 26628-22-8; MilliporeSigma). After washing three times with TBST, the membranes were incubated at room temperature for 1 h with the secondary antibody (Anti-mouse IgG HRP-linked antibody; 1:5,000; cat. no. 7076S; Anti-rabbit IgG HRP-linked antibody; 1:10,000; cat. no. 7074; Cell Signaling Technology, Inc.). Following secondary antibody incubation, the membranes were washed four times again and then completely covered with a 1:1 mixture of HRP substrate peroxide solution/HRP substrate Luminol reagent (cat. no. WSKLS0500; MilliporeSigma). Band visualization was conducted using the Fusion Solo system (Vilber Lourmat Deutschland GmbH) and analyzed with ImageJ software (version 1.53m; National Institutes of Health, USA).

Reverse transcription-quantitative (RT-q) PCR

Total RNA was extracted from cells using TRIzol® reagent (Thermo Fisher Scientific, Inc.) according to the manual instructions. cDNA was generated with M-MLV reverse transcriptase (cat. no. M170B; Promega Corporation). mRNA expression was determined by qPCR on a CFX96 real-time PCR System (Bio-Rad Laboratories, Inc.) using TOPreal SYBR Green qPCR premix kit (cat. no. RT500M; Enzynomics), using GAPDH as the internal loading control. The primer sequences for PCR were as follows: human CD46 (Forward: 5′-CCACGACCATTTGAAGCTAT-3′, Reverse: 5′-TCCAGGTGCTGGATCACAC-3′), human MMP-9 (Forward: 5′-CATCGTCATCCAGTTTGG-3′, Reverse: 5′-GATGGATTGGCCTTGGAA-3′) and human GAPDH (Forward: 5′-GAAGGTGAAGGTCGGAGTC-3′, Reverse: 5′-GAAGATGGTGATGGGATTTC-3′). PCR cycling conditions for all samples included: 10 min at 95°C for enzyme activation, followed by 40 cycles consisting of melting (95°C; 15 sec) and annealing/extension (72°C; 30 sec) phases. The data were analyzed as previously described (33). Briefly, using the comparative CT method, the Ct values obtained were converted to picogram quantities based on each gene's standard curve from target cDNA. The quantity of CD46 and MMP9 were normalized to GAPDH and adjusted by subtracting values from no reverse transcriptase controls, averaging the result for each triplicate (34).

Transient of CD46 short interfering (si)RNA

Two variants of CD46 siRNA (CCAAAACCCUACUAUGAGA, GGAUACUUCUAUAUACCUCUU) and negative control siRNA (UGCAGGUUUAUAGUCCACAUU) were procured from Bioneer Corporation. 5637 cells underwent transfection with these siRNAs using Lipofectamine® RNAiMAX transfection reagent (cat. no. 13778-075; Invitrogen; Thermo Fisher Scientific, Inc.), adhering to the manufacturer's protocol. Cells were cultured in six-well plates until they reached 60% confluence. To prepare the transfection mix, 7.5 µl Lipofectamine® RNAiMAX was diluted in 150 µl Opti-MEM Medium (Gibco; Thermo Fisher Scientific, Inc.) and mixed. DNA siRNA (25 pmol) was diluted in 150 µl Opti-MEM Medium and mixed. The diluted DNA was then combined with the previously diluted Lipofectamine® RNAiMAX, at a 1:1 ratio, to form a DNA-lipid complex. This complex was allowed to incubate for 15 min at room temperature to a stable DNA-lipid complex. Then, the complex was administered to the cultured cells. Following transfection, the cells were incubated at 37°C. At 6 h post-transfection, the cells were chanced and incubated at 37°C with media containing 5% FBS. At 48 h post-transfection, the cells were lysed for western blot analysis as described earlier.

Wound migration assay

5637, J82 and 253J cells were cultured in six-well plates until they reached 90% confluence in 2 ml of growth medium. The cells were then washed and incubated in RPMI containing 0.5% FBS for 16 h. A sterile 200 µl pipette tip was used to scrape the cell monolayer. Subsequently, the cells were gently washed thrice with PBS and FBS-free medium was added for starvation culture at 37°C. Images were captured at 0, 12 and 24 h post-scraping using an inverted microscope (Olympus IX51; Olympus Corporation). The open wound area percentages were measured and calculated with ImageJ software (version 1.53m; National Institutes of Health).

Transwell assays

The migration devices (cat. no. 3422; Corning, Inc.) and invasion devices (cat. no. 354483; Corning, Inc.) were subjected to room temperature equilibration for 10 min, then the two devices were incubated for 2 h in a 37°C incubator, and 300-µl serum-free RPMI was added in the upper chamber and 600 µl in the lower chamber. Cells at 80-90% confluence were washed and incubated in RPMI with 0.1% FBS for 16 h prior to their application to the chambers. Subsequently, 5637 and J82 cells (5×104) in 200 µl of serum-free medium were seeded into the upper chamber and the lower chambers were filled with 600 µl of RPMI media containing 10% fetal bovine serum. After a 24-h incubation, cells on the bottom membrane of the chamber were gently wiped with a cotton swab and migrating cells were stained with Diff-Quik stain solution (cat. no. 38721; Sysmex Corporation) at room temperature. After drying, images were captured under a light microscope (Olympus IX51; Olympus Corporation) and cells were counted in four fields per chamber.

Cell proliferation assay

Cell proliferation was assessed using the WST-1 assay (EZ-Cytox Cell Viability Assay kit; ITSBio, Inc.), following the manufacturer's instructions. Briefly, cells were seeded in 96-well plates with 100 µl of RPMI media containing 10% FBS and cultured at 37°C. Then, at the indicated time points (0, 24, 48 and 72 h), 10 µl of the kit solution was added to the cells, followed by a 30-min incubation at 37°C. Cell viability was measured at 450 nm using an Epoch Microplate Spectrophotometer (BioTek Instruments, Inc.).

Gelatin zymography

Cells at 80-90% confluence were washed and incubated in RPMI without FBS for 24 h in 60 mm plates. The samples were then electrophoresed on a 7.5% SDS-polyacrylamide gel containing 1 mg/ml gelatin. Post-electrophoresis, the gel was washed twice for 2 h at room temperature using a washing buffer [50 mM Tris-HCl (pH 7.5), 5 mM CaCl2, 1 µM ZnCl2 and 2.5% Triton X-100] and then briefly rinsed with H2O. Subsequently, the gel was incubated with 1X of Zymogram developing buffer 10X, pH 7.45 (cat. no. 42620000-2; Bioworld Technology, Inc.) at 37°C for 24 h. After incubation, the gels were stained with Coomassie Brilliant Blue R-250 Staining Solution (cat. no. 1610436; Bio-Rad Laboratories, Inc.) and destained with Coomassie Brilliant Blue R-250 Destaining Solution (cat. no. 1610438; Bio-Rad Laboratories, Inc.).

Luciferase assay

Transcriptional activity was assessed using a luciferase assay system. The pGL4.17[luc 2/Neo] vector, containing the MMP9 promoter region (−924/+13), known as the MMP9-luc promoter, was used. The MMP9-luc vector was kindly provided by Dr Young-Han Lee (Konkuk University, Korea). The AP-1-luc vector was obtained from Stratagene (Agilent Sumitomo Dainippon Pharma Co., Ltd.). CD46-overexpressing and control cells were seeded in a 24-well plate at a density of 1×105 cells per well and cultured for 24 h. The cells were transfected with 0.1 µg of the reporter vector and 2 ng of Renilla using Lipofectamine 2000® (Invitrogen; Thermo Fisher Scientific, Inc.) following the manufacturer's instructions. At 6 h post-transfection, the cells were washed and cultured with media containing 5% FBS at 37°C for 18 h. The addition of SB202190 or LY294002 was at 24 h post-transfection. 24 h following addition of inhibitor, luciferase and Renilla activities were measured. Light signals were detected using the Dual-Luciferase Reporter Assay System (Promega Corporation) and a Glomax Navigator instrument (Promega Corporation), in accordance with the manufacturer's instructions.

MMP9 ELISA

Cell media or mouse sera were collected under sterile conditions, immediately frozen and stored at −20°C until use. MMP9 concentration was determined using the human MMP9 Quantikine ELISA Kit (cat. no. DMP900; R&D Systems), following the manufacturer's instructions.

Xenograft model and lung metastasis model

A total of 28 female BALB/c nude mice (6-weeks-old; 17-22 g; Orient Bio, Inc.) were housed under specific pathogen-free conditions in the animal facility at the Hwasun Biomedical Convergence Center, with a 12-h light/dark cycle (light from 7:00 am to 7:00 pm) and controlled temperature maintained at 24±2 °C for optimal growth, while maintaining a relative humidity range of 50±10%. The mice were allowed ad libitum access to water and food pellets (PicoLab 5053). All procedures performed in studies were approved by the Animal Use and Care Committees at Chonnam National University Medical School (approval no. H2022-70). Mice were used to establish lung metastasis models through tail vein inoculation with 1.5×106 UM-UC-3 and 5637 cells. For each cell line, mice were randomly assigned to the experimental group (overexpressing CD46) and the control group (7 mice per group). Overall survival and physiological signs of mice in the groups were monitored daily (for a period of 6 weeks). If the animals reached any of the following humane endpoints, they were sacrificed: Animal weight loss >20%; severely decreased mobility/activity, moribund behavior or wasting syndrome. Notably, none of the mice suffered from those signs of illness or mortality during the experimental process. At the end of the experiment, the mice were deeply anesthetized with 5% isoflurane (Ifran; Hana Pharm, Co., Ltd.) to minimize any potential pain or distress during the procedure, followed by cervical dislocation to sacrifice the mice. Their blood was collected via the left ventricle using a 23-25 gauge needle. The lung metastasis tumors' fluorescence was detected using the FOBI Fluorescence In Vivo Imaging System (Cellgentek, Co., Ltd.). Additionally, lung and liver tissues were fixed with 10% buffered formalin at 4°C for 48 h. Then tissues were washed three times with PBS 1X and dehydrated with increasing alcohol concentration from 30 to 100% within 4 h and xylene within 1 h, embedded in paraffin and sliced into 5-µm serial sections and subsequently analyzed through H&E staining at room temperature for 1 min 40 and 15 sec and immunohistochemistry.

Immunohistochemical staining

Tumor paraffin (5 µm) sections from the mice were deparaffinized and rehydrated in graded alcohols and distilled water. Then they initially treated with 3% H2O2 in 60% methanol for 10 min and then incubated with Immuno-Block reagent (BioSB, Santa Barbara, CA) for 30 min at room temperature. These sections were further incubated overnight at 4°C with primary antibodies against MMP9 (1:200; cat. no. HPA001238; Atlas Antibodies AB). For the secondary antibody, anti-rabbit immunoglobulin IgG (1:500; cat. no. 30014; Vector Laboratories, Inc.) was used and incubated for 1 h at room temperature. Immunoreactivity was then visualized using an enhanced DAB kit (Abcam). The results were observed using a light microscope.

Statistical analysis

GraphPad Prism software (Dotmatics) was employed for all statistical analyses. Comparison of two data sets was done with two-tailed unpaired Student's t-test in case of normal distributed data, or with U-Mann Whitney test in case of non-parametric data, considering P-values <0.05 as statistically significant. Multiple groups were analyzed by one-way ANOVA followed by Tukey's post hoc test or two-way ANOVA followed by Bonferroni's post hoc test. The results are presented as mean ± standard deviation.

Results

Forced expression of CD46 alters expression of MMP9 in bladder cancer cells

The observations indicated that ~50% of bladder cancers exhibit an overexpression of CD46 compared with normal urothelia (29). CD46 typically acts as a protector against complement-mediated cytotoxicity in cells. Previous studies reported that CD46 also shields cancer cells from the indirect cytotoxic effects of cetuximab (an EGFR inhibitor), by modulating AKT and ERK phosphorylation in bladder cancer cells (16). The direct role of intracellular CD46 in cancer cells, however, remains poorly understood. Recently, we found that overexpression and suppression of CD46 in bladder cancer cells regulated several genes associated with migration and invasion, as identified by DNA microarray analysis (30). These genes include matrix Gla protein (MGP) and keratin 13 (KRT13) (30). Therefore, the present study explored whether CD46 affected the expression and activity of MMPs, which are pivotal in cancer cell invasion and metastasis across various types of cancer. Focusing on MMP2 and MMP9, known to play significant roles in bladder cancer metastasis (35), the present study examined if forced CD46 expression could alter their expression levels. Previously described stable transfectants overexpressing CD46 in bladder cancer cells (5637, J82, UM-UC-3, 253J and HT1376) and melanoma cells (M010119) were used (29,36). Additionally, LNCaP prostate cancer cells, HCT116 colon cancer cells and A549 lung cancer cells were transfected with pBlasti-CD46 vectors, using pBlasti as control (vehicle group). Western blotting analysis revealed that CD46 overexpression stimulated MMP9 expression in 5637, J82 and UM-UC-3 cells, but not evidently in 253J cells (Fig. 1A). In HT1376 cells, where CD46 previously showed a stimulatory effect on migration (30), MMP9 expression remained unchanged. By contrast, most non-bladder cancer cells (LNCaP, HCT116 and A549) did not exhibit enhanced MMP9 upregulation with CD46, except for M010119 melanoma cells, which showed a marked increase in MMP9 expression. In all tested cells, CD46 stimulation of MMP2 expression was not observed, with the exception of M010119. Given the consistent upregulation of MMP9 mediated by CD46, the present study focused on three bladder cancer cell lines that exhibited increased MMP9 expression (5637, J82 and UM-UC-3). To determine the effect of CD46 overexpression on cancer cell proliferation, a cell proliferation assay was conducted over three days. The results indicated that CD46 overexpression did not significantly affect cell proliferation in these three bladder cancer cells (Fig. 1B; P>0.05 by Mann-Whitney U test), thus underscoring the CD46-induced MMP9 overexpression. These findings suggested that CD46 selectively enhances the expression of MMP9, a key factor in cancer metastasis, in bladder cancer cells.

Figure 1

Expression of MMP9 by CD46 in bladder cancer cells. (A) Observation of MMP2 and MMP9 expression in five bladder cancer cell lines with CD46 overexpression, analyzed by western blotting. (B) Assessment of CD46 overexpression's impact on cell growth using an in vitro proliferation assay in cells overexpressing MMP9 due to CD46. Data are presented as mean ± SD. P-values were obtained using the U Mann Whitney test (nsP>0.05). MMP9, matrix metalloproteinase 9; veh, vehicle; MMP2, matrix metalloproteinase 2.

CD46 promotes phosphorylation of p38 MAPK, PI3K/AKT and AP-1

To elucidate the mechanism behind CD46's role in elevating MMP9 expression, the present study examined several key signaling pathways that govern MMP9 regulation. There is mounting evidence indicating the involvement of both MAPK and PI3K/AKT cascades in MMP9 regulation (27,37,38). The primary constituents of the MAPK family include ERK, p38 and JNK, while PI3K/AKT is crucial for cell survival and growth (39). Investigating the potential link between CD46 and MMP9, the present study assessed alterations in the MAPK and PI3K/AKT pathways in bladder cancer cells exhibiting CD46-induced MMP9 expression. As depicted in Fig. 2A, CD46 stimulation not only enhanced MMP9 expression but also increased phosphorylation levels of p38 MAPK and AKT proteins in all three cell lines examined. The right panel of Fig. 2A presents a quantitation graph corresponding to the left panel. No significant changes were observed in JNK and ERK phosphorylation across the cell lines, with the exception of p-ERK in UM-UC-3 cells (Student's t-test; P<0.0001). To minimize potential nonspecific effects of overexpression via viral vectors, we introduced CD46 siRNA (siCD46) into 5637 cells through transient transfection. CD46 suppression effectively reduced MMP9 expression and decreased phosphorylation of p38 and AKT (Fig. 2B; Student's t-test; P<0.0001). Jun and Fos family proteins form a dimeric complex of activator protein-1 (AP-1), influenced by both MAPK and PI3K/AKT pathways (37,38,40,41). Fig. 2A illustrated that CD46 overexpression also led to increased phosphorylation of c-Jun, but not c-Fos, in all three cell lines tested (Student's t-test; P<0.0001). These results indicated that CD46 enhanced the activation of p38 MAPK and PI3K/AKT in bladder cancer cells, which appears to be associated with increased MMP9 expression, suggesting a potential role of CD46-mediated activation in bladder cancer metastasis through the p38 MAPK and PI3K/AKT pathways.

Figure 2

Effects of CD46 on MAPK and PI3K/AKT pathways. (A) Western blot analysis of bladder cancer cells overexpressing CD46 for indicated proteins. The right panel quantitatively displays the proteins from the left panel. Phosphorylated protein levels were normalized to total protein levels. (B) Treatment of 5637 cells with two types of CD46 siRNA and subsequent western blot analysis for p38 and AKT. Quantitative results are shown in the right panel. Phosphorylated protein levels were normalized to total protein levels. Each bar represents mean ± SD. Statistical significance between groups was assessed using a two-tailed unpaired Student's t-test for A and one-way ANOVA with Tukey multiple comparisons test for B. #P<0.0001 vs. control cells. veh, vehicle; MAPK, mitogen-activated protein kinase; PI3K, phosphatidylinositol 3-kinase; AKT, protein kinase B; si, short interfering; NF-κB, nuclear factor kappa B; p-, phosphorylated.

CD46 activates p38 MAPK and PI3K/AKT through phosphorylation of c-Jun to promote expression of MMP9

To examine the influence of CD46 on MMP9 transcription, the present study conducted RT-qPCR in 5637 cells. The results showed that CD46 overexpression significantly increased MMP9 mRNA levels (Fig. 3A; P<0.01). Additionally, reporter gene transcription assays with MMP9 or AP-1 promoters revealed CD46-induced upregulation of both MMP-9 and AP-1 promoter activities in all three cell types examined (Fig. 3B; P<0.01). Subsequently, the present study explored if CD46-mediated MMP9 overexpression involved p38 MAPK and PI3K/AKT pathway activation. UM-UC-3 cells were treated with specific inhibitors: p38 inhibitor SB202190 (20 µM) and AKT inhibitor LY294002 (10 µM) for 24 h. The results, depicted in Fig. 3C, demonstrated that both inhibitors significantly reduced CD46-induced MMP9 promoter activity (P<0.0001) and AP-1 activity (P<0.01). Moreover, these inhibitors also decreased CD46-stimulated MMP-9 protein overexpression in 5637 and J82 cells, as confirmed by western blot analysis (Fig. 3D; P<0.0001). Collectively, these findings suggested that CD46 enhanced MAPK and AKT signaling, leading to AP-1-mediated transcription and, consequently, increased MMP9 expression in bladder cancer cells.

Figure 3

Effects of specific inhibitors on p38 and AKT in CD46-mediated MMP9 promotion. (A) RT-qPCR of total RNA from 5637 cells to assess CD46 and MMP9 expression levels. (B) Transfection of bladder cancer cells with either AP-1-luc or MMP9-luc plasmids, followed by reporter gene transcription analysis. (C) UM-UC-3 cells underwent a reporter gene transcription assay to evaluate the effect of p38 (SB202190) and AKT (LY294002) inhibitors on CD46-mediated transcriptional activities of AP-1 (left panel) and MMP9 (right panel). (D) Treatment of both 5637 and J82 cells with indicated inhibitors for 24 h, followed by western blot analysis. Densitometric analysis of MMP9 expression is displayed as bar graphs at the bottom of each blot. Each bar represents mean ± SD. Statistical differences between groups were determined using a two-tailed unpaired Student's t-test for A and B and two-way ANOVA with Bonferroni multiple comparisons test for C and D. *P<0.01, **P<0.001, ***P<0.0001 vs. control cells. veh, vehicle; AKT, protein kinase B; MMP9, matrix metalloproteinase 9; RT-qPCR, reverse transcription-quantitative PCR; AP-1, activator protein 1.

CD46-stimulated MMP9 promotes migratory and invasive potential of bladder cancer cells in vitro

To explore the functional impact of CD46-stimulated MMP9 expression, the bioactivity of MMP9 secreted by 5637 and J82 cells was analyzed using gelatin zymography. This revealed that CD46 markedly elevated the gelatinase activity of MMP9 in cells overexpressing CD46 (Fig. 4A). It was also observed that CD46 is actively secreted into the cell culture media in CD46-overexpressed cancer cells (bottom panel of Fig. 4A). MMP9 is known to actively cleave membrane CD46 to increase soluble CD46 (42,43). Additionally, MMP9 levels secreted into the media were quantified by ELISA, finding significantly elevated MMP9 levels in the media of both cell types (Fig. 4B; P<0.01 for both 5637 and J82). The influence of CD46 on cell migration and wound healing was further investigated using wound-healing assays. Here, the width of the healed gap was measured after a specified incubation period. As depicted in Fig. 4C, CD46 overexpression significantly accelerated wound repair in 5637 and J82 cells at each time point (P<0.001). In 253J cells in which CD46 did not upregulate MMP9 expression, CD46 did not affect the wound repair capability of cells (Fig. S1). Furthermore, to confirm the role of CD46 in promoting bladder cancer cell migration and invasion, Transwell migration and invasion assays were conducted. Post-incubation, filters were stained and examined under a microscope at randomly chosen areas to count cells. CD46 overexpression substantially increased both migration and invasion in 5637 and J82 cells (Fig. 4D; P<0.01). Correspondingly, suppression of CD46 by siRNA caused 5637 cells to slow wound repair and decreased migration and invasion (Fig. S2). These findings suggested that the upregulation of MMP9 expression induced by CD46 was linked with enhanced bioactivity and secretion of MMP9 in bladder cancer cells.

Figure 4

Effects of CD46 on the regulation of migratory and invasive potential in bladder cancer cells. (A) Media from specified cells were collected for analysis. Non-reducing gelatin SDS-PAGE was used to demonstrate gelatinase activity (top panel) and western blot analysis was conducted to show secreted CD46 (lower panel). (B) Media from cells were analyzed by ELISA assay to show secreted MMP9. (C) Bright-field images showing scratched areas (marked by white lines) in confluent monolayers of cancer cells overexpressing CD46 at different time points (left panel). Relative wound closure was assessed by measuring the width of the wounds compared with control cells (right panel). (D) Transwell assays to measure cell migration and invasion in 5637 and J82 cells transfected with CD46 (left panel). Quantification of cell migration and invasion was conducted (right panel). Each bar represents mean ± SD. All scale bars, 200 µm. Differences between groups were assessed using a two-tailed unpaired Student's t-test. *P<0.01, **P<0.001, ***P<0.0001 vs. control cells. veh, vehicle; MMP9, matrix metalloproteinase 9; MMP2, matrix metalloproteinase 2.

CD46 promotes bladder cancer metastasis in vivo

To explore the effect of CD46 overexpression in a live experimental metastasis model, 5637 cells were injected into the tail vein of nude mice, with seven mice in each group. Over a period of six weeks following the injection, the weight of the mice was monitored. The results indicated that CD46 overexpression did not significantly alter the weight of the mice groups (Fig. S3A; P>0.05; Mann-Whitney U test). At the end of the six-week period, the mice were sacrificed and examined for metastatic tumor nodules in the lung and liver. Gross and fluorescent examinations of the lung surfaces were conducted (Fig. S3B and C). The lungs of the mice injected with 5637 cells displayed multiple positive fluorescence foci, as shown in a representative image (Fig. 5A). The lung tissues were fixed and embedded in paraffin to identify metastatic tumor nodules within the lung parenchyma. Serial lung tissue sections, taken every 1-2 mm up to 5 sections, were stained with H&E and the tumor nodules counted. The number of lung metastases was significantly higher in the CD46-5637 cells group, with 6 out of 7 mice showing more than one micrometastatic nodule, in contrast to almost none in the control group (Fig. 5B; P=0.04). The average tumor area in lung metastatic nodules of the CD46-5637-injected mice was 11.99±0.19 mm2, compared with >1 mm2 in control cell-injected mice (data not shown). The entire microscopic examination of the lung tissues is shown in Fig. S3D. Fig. 5C (a-f) shows a representative lung tissue with a tumor nodule. Immunohistochemical staining revealed that the metastasized tumor cells did not significantly overexpress MMP9 (Fig. 5C, g-h). No tumor nodules were detected in the liver of any mice. Additionally, serum analysis during sample collection showed that mice injected with CD46-overexpressing cells had higher blood levels of MMP9 compared with those injected with control cells, as determined by ELISA (Fig. 5D). These results demonstrated a significant increase in lung metastasis in mice due to CD46 overexpression. While overexpression of MMP9 in these metastatic tumor nodules was not definitively positive, the higher MMP9 levels in the blood of mice injected with CD46-overexpressing cells suggested a potential association between CD46, MMP9 expression and tumor metastasis.

Figure 5

Effects of CD46 on experimental lung metastasis in a murine bladder cancer model. Nude mice were injected intravenously with 5637 cells. After 6 weeks, they were sacrificed for analysis of metastatic lung tumor nodules. (A) Optical images of lung metastasis in athymic nude mice injected with 5637-veh and 5637-CD46 cells (n=7 each group). (B) Quantification of lung tumor nodules in each mouse group. Each dot represents an individual mouse. (C) Histological examination of lungs from CD46-5637 and veh-5637 injected mice (a-c). High magnification images of corresponding lungs (d-f) and (g and h) immunohistochemical images for MMP9 expression in a and b. Scale bar, 2 mm (a-c), 200 µm (d-h). (D) ELISA analysis of sera from mice before termination for serum MMP9 levels. Data represented as mean ± SD. Each dot represents an individual mouse. Statistical differences determined by paired two-tailed Student's t-test. veh, vehicle; MMP9, matrix metalloproteinase 9.

Discussion

CD46 is a protein with diverse roles in various biological processes, notably in inhibiting complement activation. This function is essential for preventing excessive or inappropriate activation of the complement system, which could lead to tissue damage and autoimmune disorders. Apart from complement regulation, CD46 has been implicated in several diseases, including different types of cancer. Our previous research established that restoring CD46 expression in bladder cancer cells offers protection against the inhibitory effects of cetuximab on AKT and ERK phosphorylation. Furthermore, this restoration shields cells from complement-dependent cytotoxicity and antibody-dependent cellular cytotoxicity induced by cetuximab. Consequently, CD46 plays a protective role in cancer, counteracting direct cytotoxicity (through peripheral blood mononuclear cells or the complement system) and indirect cytotoxicity exerted by cetuximab in bladder cancer cells. We have also shown that CD46 target gene expression profiling in HT1376 bladder cancer cells using DNA microarray identified MGP and keratin 13 (KRT13) as CD46 responsive proteins; both are associated with cell migration and invasion. Overexpression of CD46 was found to enhance the migratory potential of bladder cancer cells (30). The present study aimed to investigate the effect of CD46 on MMP9 expression and bladder cancer progression. The findings indicated that CD46 facilitates bladder cancer cell migration and invasion via MMP9 expression. In a mouse model of cancer metastasis, achieved through tail vein injection, CD46 overexpression led to a significant increase in bladder cancer lung metastatic lesions. Notably, while metastatic tumors did not markedly overexpress MMP9, elevated levels of MMP9 were detected in the serum of mice injected with CD46 overexpressing 5637 bladder cancer cells. Although a number of studies are focused on the role of CD46 as a protector for complement-mediated cytotoxicity and a viral receptor for cancer therapeutics, there are several studies reporting CD46 expression as a cancer progression and recurrence indicator. In breast cancers, expression of CD46 was positively associated with tumor grade and tumor recurrence and also indicative of decreased progression-free time and overall survival time (9,12). CD46 was also highly correlated with shorter revival-free time in ovarian cancers and increased liver metastasis in colorectal cancers (13,42). Altogether, this suggests that upregulated MMP9 can be rapidly secreted into the extracellular matrix and bloodstream in a tumor microenvironment. Most MMPs, including MMP9, are secreted as inactive proproteins and are activated upon cleavage by extracellular proteinases (43).

The present study also demonstrated that CD46-mediated MMP9 activation occurs through p38 MAPK and PI3K/AKT, which further stimulates AP-1, particularly the activation of c-Jun protein. Currently, the exact mechanism by which CD46 activates the p38 MAPK or PI3K/AKT pathways remains to be elucidated. Nonetheless, substantial evidence links the transmembrane protein CD46 to cytoskeletal proteins and the MAPK pathway. CD46 has been long associated with the maintenance of intestinal epithelial barrier integrity (44). It directly interacts with Ste20/SPS-1-related kinase (SPAK) and the cytoplasmic part of E-cadherin (45). SPAK is also involved in the MAPK pathway. E-cadherin, a transmembrane protein, plays an essential role in cell-to-cell adhesion. Activation of CD46 on intestinal epithelial cells leads to a rapid decrease in tight junction integrity (44). Furthermore, CD46 activation results in cell proliferation and migration, aligning with the effects observed following reduced contact inhibition (46). MMPs play a role in various physiological processes, including embryonic development, reproduction, tissue remodeling and carcinogenesis. MMP9, a key MMP member, primarily degrades collagen type IV in the basement membrane. MMP9 expression, observed in various cancers, is thought to aid tumor cell metastasis (47). Activation of EGFR stimulates the phosphorylation of AKT, MAPK and JNK (37). The MMP9 promoter region contains multiple transcription factor binding sites, including those for NF-κB, SP-1, Ets, AP-1 and retinoblastoma (19). Previous research has shown that MMP9 is upregulated in bladder cancer cells through the activation of p38 MAP kinase pathways (48) and the AKT pathway (49).

The present study focused on activating AP-1 to understand the CD46-mediated activation of p38 MAPK and/or AKT and its role in regulating MMP9. AP-1 induction, mostly driven by the JNK and p38MAPK pathways in response to various stimuli, is well-documented (50). Upon activation, JNKs move to the nucleus, phosphorylating c-Jun, which enhances its transcriptional activation capabilities through homodimerization or heterodimerization with c-Fos (51). The findings of the present study indicated that the upregulation of MMP9, stimulated by CD46, is primarily facilitated through the activation of c-Jun phosphorylation, rather than c-Fos. It is plausible that other transcription factors, such as NF-κB or SP-1, are also influenced by CD46 in regulating MMP9. The presence of AP-1 sites ~70 bp upstream from the transcriptional start site of the MMP9 gene is considered to play a crucial role in the transcriptional activation of MMP promoters (52). Moreover, the transactivation of the MMP9 promoter necessitates the specific interaction of AP-1 with other cis-acting elements and certain transcription factors binding to these sequences (53). Further research is required to delineate the intricate transcriptional regulation of the MMP9 promoter and enhancer regions.

The major limitation of the present study is that it did not survey MMP9 and CD46 expressions in bladder cancer patients, which is a potent tool for studying CD46 progression and development. In the future, it is planned to assess the correlation of MMP9 and CD46 expressions with stages of bladder cancer patients.

In conclusion, the results suggested that CD46 enhanced bladder cancer cell migration, invasion and metastasis. The present study also underscored the potential role of MMP9 in the metastatic process via the MAPK and AKT pathways activation (Fig. 6). CD46 could be integral in regulating these biological processes and may serve as a viable target for therapeutic intervention in bladder cancer metastasis.

Figure 6

Model of CD46-induced MMP9 upregulation in bladder cancer cells. This figure proposes a model for CD46-mediated promotion of bladder cancer metastasis. Transmembrane receptor CD46 activates hyperphosphorylation of p38 MAPK and PI3K/AKT, leading to c-Jun activation in the AP-1 complex at the MMP9 promoter. Increased MMP9 secretion into the extracellular matrix enhances migration and invasion of bladder cancer cells. Secreted MMP9 may also cleave the extracellular domain of CD46, potentially regulating overstimulation of CD46-mediated MMP9 expression. The model was created using BioRender.com. MMP9, matrix metalloproteinase 9; MAPK, mitogen-activated protein kinase; PI3K, phosphatidylinositol 3-kinase; AKT, protein kinase B; AP-1, activator protein 1.

Supplementary Data

Availability of data and materials

The data generated in the present study are included in the figures of this article.

Authors' contributions

TNT performed the experiments, data analysis and preparation of the original draft. HDT, VTN and SYK contributed to the investigation, methodology, review and editing of the final manuscript. CM assisted in the animal studies. ECH aided the clinical background of study and final version of the manuscript. CJ contributed to the conceptualization, supervision, funding acquisition, review, revision and approval of the manuscript. TNT and CJ confirm the authenticity of all the raw data. All authors have read and approved the final version of this manuscript.

Ethics approval and consent to participate

All animal procedures were approved by the Animal Use and Care Committees at Chonnam National University Medical School (approval no. H2022-70).

Patient consent for publication

Not applicable.

Competing interests

The authors declare that they have no competing interests.

Abbreviations:

AKT

protein kinase B

AP-1

activator protein 1

EGFR

epidermal growth factor receptor

ELISA

enzyme-linked immunoabsorbent assays

ERK

extracellular signal-regulated kinases

Ets

E-twenty six

FBS

fetal bovine serum

H&E

hematoxylin and eosin

JNK

c-Jun N-terminal kinases

KRT13

keratin 13

MAPK

mitogen-activated protein kinase

MGP

matrix Gla protein

MMLV

moloney murine leukemia virus

MMP2

matrix metalloproteinase 2

MMP9

matrix metalloproteinase 9

MMPs

matrix metalloproteinases

NF-κB

nuclear factor kappa B

PI3K

phosphatidylinositol 3-kinase

RT-qPCR

reverse transcription-quantitative PCR

SP-1

specificity protein 1

SPAK

Ste20/SPS-1-related kinase

Acknowledgements

Not applicable.

Funding

The present study was supported by a National Research Foundation of Korea grant funded by the Korean government (Ministry of Science and ICT; grant no. 2022R1A2C1003206).

References

1 

Yamamoto H, Fara AF, Dasgupta P and Kemper C: CD46: The 'multitasker' of complement proteins. Int J Biochem Cell Biol. 45:2808–2820. 2013. View Article : Google Scholar : PubMed/NCBI

2 

Andrews PW, Knowles BB, Parkar M, Pym B, Stanley K and Goodfellow PN: A human cell-surface antigen defined by a monoclonal antibody and controlled by a gene on human chromosome 1. Ann Hum Genet. 49:31–39. 1985. View Article : Google Scholar : PubMed/NCBI

3 

Hourcade D, Garcia AD, Post TW, Taillon-Miller P, Holers VM, Wagner LM, Bora NS and Atkinson JP: Analysis of the human regulators of complement activation (RCA) gene cluster with yeast artificial chromosomes (YACs). Genomics. 12:289–300. 1992. View Article : Google Scholar : PubMed/NCBI

4 

Sherbenou DW, Aftab BT, Su Y, Behrens CR, Wiita A, Logan AC, Acosta-Alvear D, Hann BC, Walter P, Shuman MA, et al: Antibody-drug conjugate targeting CD46 eliminates multiple myeloma cells. J Clin Invest. 126:4640–4653. 2016. View Article : Google Scholar : PubMed/NCBI

5 

Xu YQ, Gao YD, Yang J and Guo W: A defect of CD4+CD25+ regulatory T cells in inducing interleukin-10 production from CD4+ T cells under CD46 costimulation in asthma patients. J Asthma. 47:367–373. 2010. View Article : Google Scholar : PubMed/NCBI

6 

Le Buanec H, Gougeon ML, Mathian A, Lebon P, Dupont JM, Peltre G, Hemon P, Schmid M, Bizzini B, Künding T, et al: IFN-α and CD46 stimulation are associated with active lupus and skew natural T regulatory cell differentiation to type 1 regulatory T (Tr1) cells. Proc Natl Acad Sci USA. 108:18995–19000. 2011. View Article : Google Scholar

7 

Fishelson Z, Donin N, Zell S, Schultz S and Kirschfink M: Obstacles to cancer immunotherapy: Expression of membrane complement regulatory proteins (mCRPs) in tumors. Mol Immunol. 40:109–123. 2003. View Article : Google Scholar : PubMed/NCBI

8 

Blok VT, Daha MR, Tijsma OM, Weissglas MG, van den Broek LJ and Gorter A: A possible role of CD46 for the protection in vivo of human renal tumor cells from complement-mediated damage. Lab Invest. 80:335–344. 2000. View Article : Google Scholar : PubMed/NCBI

9 

Madjd Z, Durrant LG, Pinder SE, Ellis IO, Ronan J, Lewis S, Rushmere NK and Spendlove I: Do poor-prognosis breast tumours express membrane cofactor proteins (CD46)? Cancer Immunol Immunother. 54:149–156. 2005. View Article : Google Scholar

10 

Kinugasa N, Higashi T, Nouso K, Nakatsukasa H, Kobayashi Y, Ishizaki M, Toshikuni N, Yoshida K, Uematsu S and Tsuji T: Expression of membrane cofactor protein (MCP, CD46) in human liver diseases. Br J Cancer. 80:1820–1825. 1999. View Article : Google Scholar : PubMed/NCBI

11 

Seya T, Hara T, Iwata K, Kuriyama S, Hasegawa T, Nagase Y, Miyagawa S, Matsumoto M, Hatanaka M, Atkinson JP, et al: Purification and functional properties of soluble forms of membrane cofactor protein (CD46) of complement: Identification of forms increased in cancer patients' sera. Int Immunol. 7:727–736. 1995. View Article : Google Scholar : PubMed/NCBI

12 

Maciejczyk A, Szelachowska J, Szynglarewicz B, Szulc R, Szulc A, Wysocka T, Jagoda E, Lage H and Surowiak P: CD46 Expression is an unfavorable prognostic factor in breast cancer cases. Appl Immunohistochem Mol Morphol. 19:540–546. 2011. View Article : Google Scholar : PubMed/NCBI

13 

Surowiak P, Materna V, Maciejczyk A, Kaplenko I, Spaczynski M, Dietel M, Lage H and Zabel M: CD46 expression is indicative of shorter revival-free survival for ovarian cancer patients. Anticancer Res. 26:4943–4948. 2006.

14 

Lu Z, Zhang C, Cui J, Song Q, Wang L, Kang J, Li P, Hu X, Song H, Yang J and Sun Y: Bioinformatic analysis of the membrane cofactor protein CD46 and microRNA expression in hepatocellular carcinoma. Oncol Rep. 31:557–564. 2014. View Article : Google Scholar :

15 

Zeng J, Xu H, Huang C, Sun Y, Xiao H, Yu G, Zhou H, Zhang Y, Yao W, Xiao W, et al: CD46 splice variant enhances translation of specific mRNAs linked to an aggressive tumor cell phenotype in bladder cancer. Mol Ther Nucleic Acids. 24:140–153. 2021. View Article : Google Scholar : PubMed/NCBI

16 

Do M, Thanh HD, To PK, Kim MS, Moon C and Jung C: CD46 protects the bladder cancer cells from cetuximab-mediated cytotoxicity. Sci Rep. 12:224202022. View Article : Google Scholar : PubMed/NCBI

17 

Merdad A, Karim S, Schulten HJ, Dallol A, Buhmeida A, Al-Thubaity F, Gari MA, Chaudhary AG, Abuzenadah AM and Al-Qahtani MH: Expression of matrix metalloproteinases (MMPs) in primary human breast cancer: MMP-9 as a potential biomarker for cancer invasion and metastasis. Anticancer Res. 34:1355–1366. 2014.PubMed/NCBI

18 

Hara I, Miyake H, Hara S, Arakawa S and Kamidono S: Significance of matrix metalloproteinases and tissue inhibitors of metalloproteinase expression in the recurrence of superficial transitional cell carcinoma of the bladder. J Urol. 165:1769–1772. 2001. View Article : Google Scholar : PubMed/NCBI

19 

Sato H and Seiki M: Regulatory mechanism of 92 kDa type IV collagenase gene expression which is associated with invasiveness of tumor cells. Oncogene. 8:395–405. 1993.PubMed/NCBI

20 

Folkman J: Angiogenesis and c-Jun. J Natl Cancer Inst. 96:6442004. View Article : Google Scholar : PubMed/NCBI

21 

Ibrahim SAE, Abudu A, Johnson E, Aftab N, Conrad S and Fluck M: The role of AP-1 in self-sufficient proliferation and migration of cancer cells and its potential impact on an autocrine/paracrine loop. Oncotarget. 9:34259–34278. 2018. View Article : Google Scholar : PubMed/NCBI

22 

Zhu G, Cheng Z, Huang Y, Zheng W, Yang S, Lin C and Ye J: MyD88 mediates colorectal cancer cell proliferation, migration and invasion via NF-κB/AP-1 signaling pathway. Int J Mol Med. 45:131–140. 2020.

23 

Johnson GL and Lapadat R: Mitogen-activated protein kinase pathways mediated by ERK, JNK, and p38 protein kinases. Science. 298:1911–1912. 2002. View Article : Google Scholar : PubMed/NCBI

24 

Cheng CY, Hsieh HL, Hsiao LD and Yang CM: PI3-K/Akt/JNK/NF-κB is essential for MMP-9 expression and outgrowth in human limbal epithelial cells on intact amniotic membrane. Stem Cell Res. 9:9–23. 2012. View Article : Google Scholar : PubMed/NCBI

25 

Jian H, Zhao Y, Liu B and Lu S: SEMA4b inhibits MMP9 to prevent metastasis of non-small cell lung cancer. Tumour Biol. 35:11051–11056. 2014. View Article : Google Scholar : PubMed/NCBI

26 

Lin CC, Kuo CT, Cheng CY, Wu CY, Lee CW, Hsieh HL, Lee IT and Yang CM: IL-1 beta promotes A549 cell migration via MAPKs/AP-1- and NF-kappaB-dependent matrix metalloproteinase-9 expression. Cell. Signal. 21:1652–1662. 2009. View Article : Google Scholar : PubMed/NCBI

27 

Ellerbroek SM, Halbleib JM, Benavidez M, Warmka JK, Wattenberg EV, Stack MS and Hudson LG: Phosphatidylinositol 3-kinase activity in epidermal growth factor-stimulated matrix metalloproteinase-9 production and cell surface association. Cancer Res. 61:1855–1861. 2001.PubMed/NCBI

28 

Funakoshi-Tago M, Tago K, Sonoda Y, Tominaga S and Kasahara T: TRAF6 and C-SRC induce synergistic AP-1 activation via PI3-kinase-AKT-JNK pathway. Eur J Biochem. 270:1257–1268. 2003. View Article : Google Scholar : PubMed/NCBI

29 

Do MH, To PK, Cho YS, Kwon SY, Hwang EC, Choi C, Cho SH, Lee SJ, Hemmi S and Jung C: Targeting CD46 enhances anti-tumoral activity of adenovirus type 5 for bladder cancer. Int J Mol Sci. 19:26942018. View Article : Google Scholar : PubMed/NCBI

30 

Nguyen TT, Thanh HD, Do MH and Jung C: Complement regulatory protein CD46 manifests a unique role in promoting the migration of bladder cancer cells. Chonnam Med J. 59:160–166. 2023. View Article : Google Scholar : PubMed/NCBI

31 

Davies B, Waxman J, Wasan H, Abel P, Williams G, Krausz T, Neal D, Thomas D, Hanby A and Balkwill F: Levels of matrix metalloproteases in bladder cancer correlate with tumor grade and invasion. Cancer Res. 53:5365–5369. 1993.PubMed/NCBI

32 

Gerhards S, Jung K, Koenig F, Daniltchenko D, Hauptmann S, Schnorr D and Loening SA: Excretion of matrix metalloproteinases 2 and 9 in urine is associated with a high stage and grade of bladder carcinoma. Urology. 57:675–679. 2001. View Article : Google Scholar : PubMed/NCBI

33 

Jung C, Kim RS, Zhang HJ, Lee SJ and Jeng MH: HOXB13 induces growth suppression of prostate cancer cells as a repressor of hormone-activated androgen receptor signaling. Cancer Res. 64:9185–9192. 2004. View Article : Google Scholar : PubMed/NCBI

34 

Livak KJ and Schmittgen TD: Analysis of relative gene expression data using real-time quantitative PCR and the 2(−Delta Delta C(T)) method. Methods. 25:402–408. 2001. View Article : Google Scholar

35 

Papathoma AS, Petraki C, Grigorakis A, Papakonstantinou H, Karavana V, Stefanakis S, Sotsiou F and Pintzas A: Prognostic significance of matrix metalloproteinases 2 and 9 in bladder cancer. Anticancer Res. 20:2009–2013. 2000.PubMed/NCBI

36 

Cho YS, Do MH, Kwon SY, Moon C, Kim K, Lee K, Lee SJ, Hemmi S, Joo YE, Kim MS and Jung C: Efficacy of CD46-targeting chimeric Ad5/35 adenoviral gene therapy for colorectal cancers. Oncotarget. 7:38210–38223. 2016. View Article : Google Scholar : PubMed/NCBI

37 

Braicu C, Buse M, Busuioc C, Drula R, Gulei D, Raduly L, Rusu A, Irimie A, Atanasov AG, Slaby O, et al: A comprehensive review on MAPK: A promising therapeutic target in cancer. Cancers (Basel). 11:16182019. View Article : Google Scholar : PubMed/NCBI

38 

Zhang W and Liu HT: MAPK signal pathways in the regulation of cell proliferation in mammalian cells. Cell Res. 12:9–18. 2002. View Article : Google Scholar : PubMed/NCBI

39 

Datta SR, Brunet A and Greenberg ME: Cellular survival: A play in three akts. Genes Dev. 13:2905–2927. 1999. View Article : Google Scholar : PubMed/NCBI

40 

Park SL, Won SY, Song JH, Kambe T, Nagao M, Kim WJ and Moon SK: EPO gene expression promotes proliferation, migration and invasion via the p38MAPK/AP-1/MMP-9 pathway by p21WAF1 expression in vascular smooth muscle cells. Cell Signal. 27:470–478. 2015. View Article : Google Scholar

41 

Shaulian E and Karin M: AP-1 in cell proliferation and survival. Oncogene. 20:2390–2400. 2001. View Article : Google Scholar : PubMed/NCBI

42 

Meng Q, Xu J, Wang J, Zhang X, Yang H, Sun H, Wu S, Aschner M, Li X, Zhang L, et al: Investigation of the enhanced antitumour potency of CD46-specific chimeric antigen receptor-T cells in human colorectal cancer liver metastases after combination with nanotherapeutics. Nano Today. 52:1019852023. View Article : Google Scholar

43 

Van den Steen PE, Dubois B, Nelissen I, Rudd PM, Dwek RA and Opdenakker G: Biochemistry and molecular biology of gelatinase B or matrix metalloproteinase-9 (MMP-9). Crit Rev Biochem Mol Biol. 37:375–536. 2002. View Article : Google Scholar

44 

Cardone J, Al Shouli S and Kemper C: A novel role for CD46 in wound repair. Front Immunol. 2:282011. View Article : Google Scholar : PubMed/NCBI

45 

Yan Y and Merlin D: Ste20-related proline/alanine-rich kinase: A novel regulator of intestinal inflammation. World J Gastroenterol. 14:6115–6121. 2008. View Article : Google Scholar : PubMed/NCBI

46 

Guillot C and Lecuit T: Mechanics of epithelial tissue homeostasis and morphogenesis. Science. 340:1185–1189. 2013. View Article : Google Scholar : PubMed/NCBI

47 

Laronha H and Caldeira J: Structure and function of human matrix metalloproteinases. Cells. 9:10762020. View Article : Google Scholar : PubMed/NCBI

48 

Lee SJ, Park SS, Lee US, Kim WJ and Moon SK: Signaling pathway for TNF-alpha-induced MMP-9 expression: Mediation through p38 MAP kinase, and inhibition by anti-cancer molecule magnolol in human urinary bladder cancer 5637 cells. Int Immunopharmacol. 8:1821–1826. 2008. View Article : Google Scholar : PubMed/NCBI

49 

Chen YT, Yang CC, Shao PL, Huang CR and Yip HK: Melatonin-mediated downregulation of ZNF746 suppresses bladder tumorigenesis mainly through inhibiting the AKT-MMP-9 signaling pathway. J Pineal Res. 66:e125362019. View Article : Google Scholar

50 

Chang L and Karin M: Mammalian MAP kinase signalling cascades. Nature. 410:37–40. 2001. View Article : Google Scholar : PubMed/NCBI

51 

Pulverer BJ, Hughes K, Franklin CC, Kraft AS, Leevers SJ and Woodgett JR: Co-purification of mitogen-activated protein kinases with phorbol ester-induced c-Jun kinase activity in U937 leukaemic cells. Oncogene. 8:407–415. 1993.PubMed/NCBI

52 

Benbow U and Brinckerhoff CE: The AP-1 site and MMP gene regulation: What is all the fuss about? Matrix Biol. 15:519–526. 1997. View Article : Google Scholar : PubMed/NCBI

53 

Gum R, Lengyel E, Juarez J, Chen JH, Sato H, Seiki M and Boyd D: Stimulation of 92-kDa gelatinase B promoter activity by ras is mitogen-activated protein kinase kinase 1-independent and requires multiple transcriptin factor binding sites including closely spaced PEA3/ets and AP-1 sequences. J Biol Chem. 271:10672–10680. 1996. View Article : Google Scholar : PubMed/NCBI

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Thi TN, Thanh HD, Nguyen V, Kwon S, Moon C, Hwang EC and Jung C: Complement regulatory protein CD46 promotes bladder cancer metastasis through activation of MMP9. Int J Oncol 65: 71, 2024.
APA
Thi, T.N., Thanh, H.D., Nguyen, V., Kwon, S., Moon, C., Hwang, E.C., & Jung, C. (2024). Complement regulatory protein CD46 promotes bladder cancer metastasis through activation of MMP9. International Journal of Oncology, 65, 71. https://doi.org/10.3892/ijo.2024.5659
MLA
Thi, T. N., Thanh, H. D., Nguyen, V., Kwon, S., Moon, C., Hwang, E. C., Jung, C."Complement regulatory protein CD46 promotes bladder cancer metastasis through activation of MMP9". International Journal of Oncology 65.1 (2024): 71.
Chicago
Thi, T. N., Thanh, H. D., Nguyen, V., Kwon, S., Moon, C., Hwang, E. C., Jung, C."Complement regulatory protein CD46 promotes bladder cancer metastasis through activation of MMP9". International Journal of Oncology 65, no. 1 (2024): 71. https://doi.org/10.3892/ijo.2024.5659
Copy and paste a formatted citation
x
Spandidos Publications style
Thi TN, Thanh HD, Nguyen V, Kwon S, Moon C, Hwang EC and Jung C: Complement regulatory protein CD46 promotes bladder cancer metastasis through activation of MMP9. Int J Oncol 65: 71, 2024.
APA
Thi, T.N., Thanh, H.D., Nguyen, V., Kwon, S., Moon, C., Hwang, E.C., & Jung, C. (2024). Complement regulatory protein CD46 promotes bladder cancer metastasis through activation of MMP9. International Journal of Oncology, 65, 71. https://doi.org/10.3892/ijo.2024.5659
MLA
Thi, T. N., Thanh, H. D., Nguyen, V., Kwon, S., Moon, C., Hwang, E. C., Jung, C."Complement regulatory protein CD46 promotes bladder cancer metastasis through activation of MMP9". International Journal of Oncology 65.1 (2024): 71.
Chicago
Thi, T. N., Thanh, H. D., Nguyen, V., Kwon, S., Moon, C., Hwang, E. C., Jung, C."Complement regulatory protein CD46 promotes bladder cancer metastasis through activation of MMP9". International Journal of Oncology 65, no. 1 (2024): 71. https://doi.org/10.3892/ijo.2024.5659
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team