Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
Oncology Letters
Join Editorial Board Propose a Special Issue
Print ISSN: 1792-1074 Online ISSN: 1792-1082
Journal Cover
August-2017 Volume 14 Issue 2

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
August-2017 Volume 14 Issue 2

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article

Effect of TERT on the growth of fibrosarcoma via caspase-3, survivin and PKB

  • Authors:
    • Qiuye Ma
    • Yidong Yu
    • Linlin Dai
    • Xuehua Qu
    • Shan Cong
    • Hongsuo Liang
  • View Affiliations / Copyright

    Affiliations: Department of Orthopedics, Chinese Medicine Hospital of Jiulongpo, Chongqing 400080, P.R. China, Department of Orthopedics, The Fourth Affiliated Hospital of Harbin Medical University, Harbin, Helongjiang 150001, P.R. China, Department of Orthopedics, Nanning Second People's Hospital, Nanning, Guangxi 530031, P.R. China
  • Pages: 1939-1942
    |
    Published online on: June 13, 2017
       https://doi.org/10.3892/ol.2017.6373
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:


Abstract

The present study explored the effect of telomerase reverse transcriptase (TERT) on the growth and apoptosis of fibrosarcoma, and investigated the potential molecular signalling pathways underlying its effect. A plasmid was constructed in order to overexpress TERT and siRNA was used to knockdown TERT. The effect of TERT on fibrosarcoma cells in vitro was studied by performing reverse transcription‑quantitative PCR and western blotting to determine the expression of p53, survivin, caspase‑3, caspase‑7 and PKB. Knockdown of TERT suppressed cell growth, decreased fibrosarcoma volume, decreased survivin and PKB expression, and increased caspase‑3 expression. The results of the present study suggest that TERT regulates the growth of fibrosarcoma in vitro and in vivo, and that this is associated with the expression of caspase‑3 and survivin, in addition to the PKB signalling pathway.

Introduction

Telomerase reverse transcriptase (TERT), known as hTERT in humans, is the catalytic component of telomerase, a type of nuclear reverse transcriptase responsible for telomere extension in cells (1). A previous study demonstrated that abnormal expression of hTERT leads to the progressive shortening of telomeres, which could induce cell immortalization and malignant tumor growth (2). The function of hTERT in vivo and in vitro was studied directly by cloning the open reading frame (ORF) of the target gene into expression vectors with different protein tags, a technique used in a previous gene function study (3).

In the current study, ORF expression cloning technology was used with the TERT gene as a target to design and construct a TERT-ORF clone vector and produce virus particles with the ability to express TERT through viral packaging. The effects of TERT on fibrosarcoma in vitro were studied.

Materials and methods

Cell lines and cell culture

Human fibrosarcoma HT1080 cells were purchased from the American Type Culture Collection (Manassas, VA, USA) and were cultured in Minimal Essential Medium supplemented with 10% fetal bovine serum (both from Gibco; Thermo Fisher Scientific, Inc., Waltham, MA, USA), 100 U/ml penicillin and 100 µg/ml streptomycin at 37°C with 5% CO2. Lenti-Pac 293Ta cells (GeneCopoeia, Inc., Rockville, MY, USA) cultured using Dulbecco's modified Eagle's medium supplemented with 10% fetal bovine serum and penicillin/streptomycin in the same conditions. Human non-small cell lung carcinoma cell line H1299 cells (American Type Culture Collection) were cultured with RPMI-1640 supplemented with 10% fetal bovine serum and penicillin/streptomycin, also in the same conditions.

Transduction of the Lv130 human immunodeficiency virus (HIV) lentiviral vector

A total of 10 ng of Lv130 HIV lentiviral vector (GeneCopoeia China Inc., Guangzhou, China) was added to 100 µl competent Escherichia coli cells (cat no., C7373-03; Invitrogen; Thermo Fisher Scientific, Inc.) and incubated on ice for 30 min, then immediately transferred to a 42°C water bath and heat shocked for 60 sec, then transferred to ice for 2 min. Super optimal culture medium (200 µl; Sigma-Aldrich China, Beijing, China) was added and the sample was incubated at 37°C with agitation for 1 h at 200 rev/min, then 100 µl was cultured on an LB plate with ampicillin at 37°C overnight. The plasmid was isolated with a Plasmid Miniprep kit (cat. no., PFM250; Sigma-Aldrich China) according to the manufacturer's protocol. Restriction endonuclease digestion and 1% agarose gel electrophoresis with ethidium bromide were performed to confirm that the TERT sequence had been incorporated into the plasmid.

Construction of the recombinant plasmid with lentivirus vector and TERT gene DNA

The TERT gene was obtained by polymerase chain reaction (PCR) analysis. The total RNA of nude mice brain (supplied by Laboratory Animal Center of the Harbin Medical University, Harbin, China) was isolated with RNeasy Plus Universal kits [cat. no. 73404; QIAGEN (Suzhou) Translational Medicine Co., Ltd., Suzhou, China] according to the manufacturer's protocol. Primers were designed according to the mouse TERT gene sequences in GenBank. Primer sequences for TERT were as follows: Forward, 5′-GCGGTAGGCGTGTACGGT-3′ and reverse, 5′-CGATCTCGAACTCGTGGC-3′. Primers contained restriction sites for NheI and Bsp119I. Reverse transcription (RT)-PCR was performed with a One Step RT-PCR kit [cat. no. 210212; QIAGEN (Suzhou) Translational Medicine Co., Ltd.]. The RT-PCR product (TERT gene) and the lentiviral vector were digested with NheI and Bsp119I restriction endonucleases. The products of enzyme digestion were purified with a QIAquick Gel Extraction kit [cat. no. 28704; QIAGEN (Suzhou) Translational Medicine Co., Ltd.] and ligated with T4 DNA ligase to construct the recombinant plasmid.

Packaging of the virus

Cells at a confluence of 70–80% were used for transfection. The lentiviral packaging plasmid mixture (including 0.5 µg recombinant plasmid and 1 µl virus) was co-transfected into 293Ta cells and H1299 cells, which were incubated at room temperature for 25 min, then added into 6-well plates and cultured at 37°C with 5% CO2. The medium containing transfection mixture residues was discarded and fresh medium was added following 12 h incubation. The cell supernatant was collected after 48 h by centrifugation (1,000 × g at 4°C for 5 min), then a 0.45 µm polyvinylidene fluoride (PVDF) film was used to filter and harvest the packaged virus particles.

Overexpression of TERT

The recombinant lentiviral overexpression vector was transfected into HT1080 cells using Lipofectamine 2000 (cat. no. 11668027; Thermo Fisher Scientific Inc.), according to the manufacturer's protocol.

RNA interference (RNAi) of TERT

HT1080 cells at confluence of 70–80% were used for RNAi. TERT-siRNA: AATCAGACAGCACTTGAAGAGGG was used for transfection of HT1080 cells using Lipofectamine 2000. Fluorescent images were captured following culture for 48 h to observe the growth status of the cells. Five images of each culture well were captured in the visual fields located in the center, upper, lower, left and right of the well.

RT-quantitative(q) PCR

Total RNA was extracted from cells subjected to the knockdown or overexpression of TERT after 72 h, using the RNeasy Mini kit (Qiagen, Inc., Valencia, CA, USA) according to the manufacturer's protocol. Total RNA (1 µg) was subjected to reverse transcription using a reverse transcription system (cat. no. A3500; Promega Corporation, Madison, WI, USA). qPCR was performed using SYBR-Green PCR Master Mix (Promega Corporation). Thermocycler conditions were as follows: 95°C for 45 sec; 95°C for 5 sec; and 60°C for 30 sec, for 40 cycles. Primers used were as follows: p53 forward, 5′-GCCATGGCCATCTACAAG-3′ and reverse, 5′-CCTTCCACCCGGATAAGAT-3′; survivin forward, 5′-TTCAAGAACTGGCCCTTC-3′ and reverse, 5′-CCTTAAAGCAGAAAAAACACTG-3′; caspase-3 forward, 5′-TTCTTCAGAGGCGACTACT-3′ and reverse, 5′-TCCCACTGTCTGTCTCAAT-3′; and caspase-7 forward, 5′-TCTTTGCTTACTCCACGGTT-3′ and reverse, 5′-ACCCTGGTCAGGATCTGCAT-3′; GAPDH (internal control) forward, 5′-TGTGGGCATCAATGGATTTGG-3′ and reverse, 5′-ACACCATGTATTCCGGGTCAAT-3′. The results were quantified using the 2−ΔΔCq method (4).

Detection of the expression of protein kinase B (PKB) with western blotting

Briefly, cells that had been subjected to the knockdown or overexpression of TERT were lysed 72 h after RNAi in lysis buffer containing 50 mM Tris (pH 7.4), 150 mM NaCl, 1% Triton X-100, 1% sodium deoxycholate, 0.1% SDS, 1 mM EDTA and protease inhibitor at 4°C for 2 h. Total protein (50 µg) was separated by 15% SDS-PAGE and transferred to a PVDF membrane. The membrane was incubated with primary antibodies against PKB (dilution, 1:1,000; United States Biological, Salem, MA, USA) at 4°C overnight. The secondary antibodies were added at a dilution of 1:1,000, incubated at RT for 2 h and the bands were stained with DAB. They were quantified using β-actin (dilution, 1:1,000; antibody cat. no. 143128; United States Biological) as the control. The protein bands were quantified using Image J software (version k 1.45; National Institutes of Health, Bethesda, MA, USA; https://imagej.en.softonic.com/).

Statistical analysis

Statistical analysis was performed using the SPSS software (version 17.0; SPSS, Inc., Chicago, IL, USA) and a one-way analysis of variance was conducted for the comparison between groups. P<0.05 was considered to indicate a statistically significant difference.

Results

Successful construction of the recombinant plasmid with the lentivirus vector and TERT gene DNA

The recombinant plasmid was isolated and confirmed to possess the ORF of the TERT gene by enzymatic digestion with restriction endonucleases NheI and Bsp119I, and sequencing of the plasmid (data not shown). Green fluorescence was observed in viable HT1080 cells following transfection with the recombinant TERT plasmid (Fig. 1), confirming expression of the plasmid.

Figure 1.

Fluorescence microscopy image of HT1080 cells following transfection with the human telomerase reverse transcriptase plasmid (magnification, ×200).

Survivin and PKB expression decreases but caspase-3 expression increases following TERT knockdown

The effects of recombinant plasmid transfection on the expression levels of p53, survivin, caspase-3 and caspase-7 in HT1080 cells were detected by RT-qPCR. There was no significant difference in the expression levels of p53 and caspase-7 genes prior to and following TERT knockdown (P>0.05; Fig. 2). However, the expression levels of survivin decreased significantly and the expression levels of caspase-3 increased significantly following TERT knockdown (P<0.05; Fig. 2). The expression levels of survivin increased significantly and the expression levels of caspase-3 decreased significantly following TERT overexpression (Fig. 2).

Figure 2.

Reverse transcription-quantitative polymerase chain reaction analysis of the expression of (A) p53, (B) caspase-3, (C) survivin and (D) caspase-7. Error bars represent standard deviation. siRNA, small interfering RNA.

Western blotting analysis revealed that the expression of PKB decreased significantly at the protein level following TERT knockdown (P<0.05), while it increased significantly when TERT was overexpressed (P<0.05; Fig. 3).

Figure 3.

Western blotting results. (A) Western blot showing PKB expression in control, TERT siRNA-treated and TERT plasmid-treated HT1080 cells. (B) Quantification of PKB protein levels from western blotting. Error bars represent standard deviation. TERT, telomerase reverse transcriptase; PKB, protein kinase B; OD, optical density; siRNA, small interfering RNA.

Discussion

The biological role of TERT is to add telomeric DNA to the end of eukaryotic chromosomal DNA to ensure the activity of cells (5). Telomeres serve an important role in maintaining cellular chromosome stability and activity in the cells of various species (6). In the present study, TERT overexpression significantly promoted the growth of HT1080 cells, while TERT knockdown significantly inhibited growth. TERT affects cell growth, as it regulates the expression of telomerase, which affects telomere length, and the length of telomeres can affect the cell growth state (7–9). Previous studies have demonstrated that TERT knockdown inhibits the growth of bladder cancer and prostate cancer (2,10). These results suggest that the TERT gene can control fibrosarcoma growth.

Previous studies have identified that TERT inhibits cell apoptosis (11,12), which could account for the increased tumor growth observed following TERT overexpression. In the current study, the expression levels of caspase-3, caspase-7, survivin and p53 were measured prior to and following TERT knockdown. TERT knockdown did not significantly affect the expression of caspase-7 or p53; however, it significantly affected the expression of caspase-3 and survivin. Survivin has been demonstrated to promote cell survival (13), whereas caspase-3 promotes apoptosis (14). In the present study, TERT overexpression and knockdown significantly decreased and increased caspase-3 expression, respectively, indicating that TERT may serve a role in the growth of fibrosarcoma through caspase-3 and survivin.

PKB is a signalling molecule that regulates cell apoptosis and survival, and serves an important role in wound repair (15,16). In the present study, TERT was identified to regulate the expression of PKB. Previous studies have demonstrated that the PKB signaling pathway is widely associated with cell apoptosis, survival, growth and protein synthesis (17–20). Signal transmission in the cytoplasm through PKB promotes cell cycle progression by glycogen synthase kinase-3 β (21), and accelerates cell apoptosis through the inhibition of p21 or p53 (22). The results of the present study suggest that TERT affects the growth of fibrosarcoma via cell survival and apoptosis through the PKB signalling pathway.

The present study established a fibrosarcoma cell model overexpressing TERT. In this cell line, the effects of TERT on cell growth appeared to be mediated through the survivin, caspase-3 and PKB signalling pathways. These results provide important information for the application of hTERT-targeted therapies for the treatment of fibrosarcoma and similar malignancies, such as giant cell bone tumors.

References

1 

Fire A, Xu S, Montgomery MK, Kostas SA, Driver SE and Mello CC: Potent and specific genetic interference by double-stranded RNA in Caenorhabditis elegans. Nature. 391:806–811. 1998. View Article : Google Scholar : PubMed/NCBI

2 

Gandellini P, Folini M, Bandiera R, De Cesare M, Binda M, Veronese S, Daidone MG, Zunino F and Zaffaroni N: Down-regulation of human telomerase reverse transcriptase through specific activation of RNAi pathway quickly results in cancer cell growth impairment. Biochem Pharmacol. 73:1703–1714. 2007. View Article : Google Scholar : PubMed/NCBI

3 

Harley CB, Futcher AB and Greider CW: Telomeres shorten during ageing of human fibroblasts. Nature. 345:458–460. 1990. View Article : Google Scholar : PubMed/NCBI

4 

Livak KJ and Schmittgen TD: Analysis of relative gene expression data using real-time quantitative PCR and the 2(−Delta Delta C(T)) Method. Methods. 25:402–408. 2001. View Article : Google Scholar : PubMed/NCBI

5 

Hastie ND, Dempster M, Dunlop MG, Thompson AM, Green DK and Allshire RC: Telomere reduction in human colorectal carcinoma and with ageing. Nature. 346:866–868. 1990. View Article : Google Scholar : PubMed/NCBI

6 

McFadden N, Bailey D, Carrara G, Benson A, Chaudhry Y, Shortland A, Heeney J, Yarovinsky F, Simmonds P, Macdonald A and Goodfellow I: Norovirus regulation of the innate immune response and apoptosis occurs via the product of the alternative open reading frame 4. PLoS Pathog. 7:e10024132011. View Article : Google Scholar : PubMed/NCBI

7 

Folini M, Brambilla C, Villa R, Gandellini P, Vignati S, Paduano F, Daidone MG and Zaffaroni N: Antisense oligonucleotide-mediated inhibition of hTERT, but not hTERC, induces rapid cell growth decline and apoptosis in the absence of telomere shortening in human prostate cancer cells. Eur J Cancer. 41:624–634. 2005. View Article : Google Scholar : PubMed/NCBI

8 

Cong YS, Wright WE and Shay JW: Human telomerase and its regulation. Microbiol Mol Biol Rev. 66:407–425. 2002. View Article : Google Scholar : PubMed/NCBI

9 

Blackburn EH, Greider CW and Szostak JW: Telomeres and telomerase: The path from maize, Tetrahymena and yeast to human cancer and aging. Nat Med. 12:1133–1138. 2006. View Article : Google Scholar : PubMed/NCBI

10 

Zou L, Zhang P, Luo C and Tu Z: shRNA-targeted hTERT suppress cell proliferation of bladder cancer by inhibiting telomerase activity. Cancer Chemother Pharmacol. 57:328–334. 2006. View Article : Google Scholar : PubMed/NCBI

11 

Gorbunova V, Seluanov A and Pereira-Smith OM: Expression of human telomerase (hTERT) does not prevent stress-induced senescence in normal human fibroblasts but protects the cells from stress-induced apoptosis and necrosis. J Biol Chem. 277:38540–38549. 2002. View Article : Google Scholar : PubMed/NCBI

12 

Liu K, Hodes RJ and Weng Np: Cutting edge: Telomerase activation in human T lymphocytes does not require increase in telomerase reverse transcriptase (hTERT) protein but is associated with hTERT phosphorylation and nuclear translocation. J Immunol. 166:4826–4830. 2001. View Article : Google Scholar : PubMed/NCBI

13 

O'Connor DS, Schechner JS, Adida C, Mesri M, Rothermel AL, Li F, Nath AK, Pober JS and Altieri DC: Control of apoptosis during angiogenesis by survivin expression in endothelial cells. Am J Pathol. 156:393–398. 2000. View Article : Google Scholar : PubMed/NCBI

14 

Porter AG and Jänicke RU: Emerging roles of caspase-3 in apoptosis. Cell Death Differ. 6:99–104. 1999. View Article : Google Scholar : PubMed/NCBI

15 

Dale-Nagle EA, Satriotomo I and Mitchell GS: Spinal vascular endothelial growth factor induces phrenic motor facilitation via extracellular signal-regulated kinase and Akt signaling. J Neurosci. 31:7682–7690. 2011. View Article : Google Scholar : PubMed/NCBI

16 

Paterniti I, Esposito E, Mazzon E, Bramanti P and Cuzzocrea S: Evidence for the role of PI(3)-kinase-AKT-eNOS signalling pathway in secondary inflammatory process after spinal cord compression injury in mice. Eur J Neurosci. 33:1411–1420. 2011. View Article : Google Scholar : PubMed/NCBI

17 

Gheysarzadeh A and Yazdanparast R: Inhibition of H2O2-induced cell death through FOXO1 modulation by EUK-172 in SK-N-MC cells. Eur J Pharmacol. 697:47–52. 2012. View Article : Google Scholar : PubMed/NCBI

18 

Park HS, Seong KM, Kim JY, Kim CS, Yang KH, Jin YW and Nam SY: Chronic low-dose radiation inhibits the cells death by cytotoxic high-dose radiation increasing the level of AKT and acinus proteins via NF-κB activation. Int J Radiat Biol. 89:371–377. 2013. View Article : Google Scholar : PubMed/NCBI

19 

Yang W, Ju JH, Lee KM, Nam K, Oh S and Shin I: Protein kinase B/Akt1 inhibits autophagy by down-regulating UVRAG expression. Exp Cell Res. 319:122–133. 2013. View Article : Google Scholar : PubMed/NCBI

20 

Zeng X, Huang Z, Mao X, Wang J, Wu G and Qiao S: N-carbamylglutamate enhances pregnancy outcome in rats through activation of the PI3K/PKB/mTOR signaling pathway. PLoS One. 7:e411922012. View Article : Google Scholar : PubMed/NCBI

21 

Siraskar B, Völkl J, Ahmed MS, Hierlmeier M, Gu S, Schmid E, Leibrock C, Föller M, Lang UE and Lang F: Enhanced catecholamine release in mice expressing PKB/SGK-resistant GSK3. Pflugers Arch. 462:811–819. 2011. View Article : Google Scholar : PubMed/NCBI

22 

Vichalkovski A, Gresko E, Hess D, Restuccia DF and Hemmings BA: PKB/AKT phosphorylation of the transcription factor Twist-1 at Ser42 inhibits p53 activity in response to DNA damage. Oncogene. 29:3554–3565. 2010. View Article : Google Scholar : PubMed/NCBI

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Ma Q, Yu Y, Dai L, Qu X, Cong S and Liang H: Effect of TERT on the growth of fibrosarcoma via caspase-3, survivin and PKB. Oncol Lett 14: 1939-1942, 2017.
APA
Ma, Q., Yu, Y., Dai, L., Qu, X., Cong, S., & Liang, H. (2017). Effect of TERT on the growth of fibrosarcoma via caspase-3, survivin and PKB. Oncology Letters, 14, 1939-1942. https://doi.org/10.3892/ol.2017.6373
MLA
Ma, Q., Yu, Y., Dai, L., Qu, X., Cong, S., Liang, H."Effect of TERT on the growth of fibrosarcoma via caspase-3, survivin and PKB". Oncology Letters 14.2 (2017): 1939-1942.
Chicago
Ma, Q., Yu, Y., Dai, L., Qu, X., Cong, S., Liang, H."Effect of TERT on the growth of fibrosarcoma via caspase-3, survivin and PKB". Oncology Letters 14, no. 2 (2017): 1939-1942. https://doi.org/10.3892/ol.2017.6373
Copy and paste a formatted citation
x
Spandidos Publications style
Ma Q, Yu Y, Dai L, Qu X, Cong S and Liang H: Effect of TERT on the growth of fibrosarcoma via caspase-3, survivin and PKB. Oncol Lett 14: 1939-1942, 2017.
APA
Ma, Q., Yu, Y., Dai, L., Qu, X., Cong, S., & Liang, H. (2017). Effect of TERT on the growth of fibrosarcoma via caspase-3, survivin and PKB. Oncology Letters, 14, 1939-1942. https://doi.org/10.3892/ol.2017.6373
MLA
Ma, Q., Yu, Y., Dai, L., Qu, X., Cong, S., Liang, H."Effect of TERT on the growth of fibrosarcoma via caspase-3, survivin and PKB". Oncology Letters 14.2 (2017): 1939-1942.
Chicago
Ma, Q., Yu, Y., Dai, L., Qu, X., Cong, S., Liang, H."Effect of TERT on the growth of fibrosarcoma via caspase-3, survivin and PKB". Oncology Letters 14, no. 2 (2017): 1939-1942. https://doi.org/10.3892/ol.2017.6373
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team